2 specifying a time delay for the application of archived redo log files

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Ngày tải lên : 18/06/2014, 16:20
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic...
  • 12
  • 573
  • 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Ngày tải lên : 19/02/2014, 06:20
... incubated at 37 °C for 20 After centrifugation, the supernatant was used to measure the absorbance at 468 nm The amounts of bilirubin formed in the reaction system were calculated using a value of ... kit (Amersham Biosciences, Piscataway, NJ, USA) Expression of a- tubulin was examined as an internal control using a- tubulin monoclonal antibody (NeoMarkers, Fremont, CA, USA) Assay for HO catalytic ... Functional analysis of cDNAs for two types of human heme oxygenase and evidence for their separate regulation J Biochem (Tokyo) 113, 214–218 Takeda K, Ishizawa S, Sato M, Yoshida T & Shibahara S...
  • 12
  • 621
  • 0
a suficient condition for the existence of periodic solution for a reation diffusion equation with infinite delay

a suficient condition for the existence of periodic solution for a reation diffusion equation with infinite delay

Ngày tải lên : 29/10/2015, 14:20
... However, for a pair of quasi-solutions hðt; xÞ and hðt; xÞ, the sector hhðt; xÞ; hðt; xÞi is an attractor of the associated initial boundary value problem Furthermore, if hðt; xÞ ¼ hðt; xÞ, then the ... the quasi-solution hðt; xÞ (or hðt; xÞ) is exactly the solution, and the asymptotic behavior of the solutions to the associated initial boundary value problem is also obtained Therefore, the sufficient ... [4] S Ahmad, A. C Lazer, Asymptotic behavior of solutions of periodic competition diffusion system, Nonlinear Anal., TMA 13 (1989) 263–284 [5] C.V Pao, Quasisolutions and global attractor of reaction...
  • 8
  • 146
  • 0
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Ngày tải lên : 14/02/2014, 13:20
... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... national, regional or local level, and to cooperate with similar fora at national level At the same time, the Platform can create input for integrating the responses to the obesity challenge into a ... diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the rising prevalence...
  • 22
  • 703
  • 0
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

Ngày tải lên : 16/02/2014, 06:20
... present case we can take πB = A , which has the great advantage that the path of ρ does not depend on the paths of the other particles This is the reason why the case DA = DB is special We proved ... collection of i.i.d mean A Poisson variables plus a finite number of particles which started at time zero at fixed locations (these are the particles added as B-particles at the start) For every ε > there ... Annals of Mathematics, 167 (2008), 701–766 A shape theorem for the spread of an infection By Harry Kesten and Vladas Sidoravicius Abstract In [KSb] we studied the following model for the...
  • 67
  • 490
  • 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Ngày tải lên : 16/02/2014, 22:20
... most available in the form of organic compounds, such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria Inasmuch as the bacteria ... from another As far as these characters can be used, they are taken, but in addition, many characteristics of a physiological nature are added The way that the organism grows in different kinds of ... frequently the cans are not cleaned immediately upon arrival at the farm, so that the conditions are favorable for rapid fermentation Many of the taints that bother factories are directly traceable...
  • 201
  • 540
  • 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Ngày tải lên : 18/02/2014, 02:20
... singular choice of edu cation, marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic ... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... Influencing the Selection of Education, Marketing, and Law There are many other variables that can influence managers in their selection of education, marketing, and/or law as classes of strategic...
  • 14
  • 780
  • 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Ngày tải lên : 07/03/2014, 10:20
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... facilitate this process may therefore be a critical factor in the Ab mediated pathology of the AD brain Subsequent to an early report demonstrating that the Cu- and Zn-induced aggregation of Ab could ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab...
  • 9
  • 634
  • 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Ngày tải lên : 07/03/2014, 12:20
... GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3¢ The PCR product was cloned into the ... acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower ... horizontal transfer of vitamin C-related genes In the process of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form...
  • 11
  • 571
  • 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Ngày tải lên : 23/03/2014, 15:21
... suggests that C paradoxa PsbU has a higher homology with the red algal protein than with the cyanobacterial one The C paradoxa thylakoid membranes also contained a band cross-reacted with anti-(R-PsbQ¢), ... text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae ... Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride...
  • 11
  • 501
  • 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

Ngày tải lên : 28/03/2014, 15:20
... suitable  for a practical  application.   On  the other hand, based on results of Nadaoka et al  [9], Ting and Kirby [15‐17], it can be estimated  that  in  the surf  zone,  the time scale  ... wave  breaking  on  a natural  beach  To  verify  the accuracy  of the numerical  model  on  the simulation  of the wave  transformation  on  a natural  beach,  existing  experimental data on the wave dynamics in  ... dissipated  when  a new wave arrives and breaks. Thus, the time variation  of TKE  is  relatively  small,  and  the combination  of wave‐induced  flow  and  undertow may transport TKE and suspended ...
  • 11
  • 460
  • 0
a novel method for the synthesis of titania nanotubes using

a novel method for the synthesis of titania nanotubes using

Ngày tải lên : 05/05/2014, 15:26
... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al /...
  • 8
  • 634
  • 0
a novel method for the synthesis of cao nanoparticle

a novel method for the synthesis of cao nanoparticle

Ngày tải lên : 06/05/2014, 08:55
... enhanced reactivity tension These substances also control both towards the toxicants makes them the potential the reduction rate of metal ions and the materials for the decomposition applications agglomeration ... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, ... capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15­ agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including...
  • 12
  • 705
  • 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

Ngày tải lên : 18/06/2014, 15:20
... Pharmacopoeia 2.6.14 (bacterial endotoxins), the validation of the sterility testing in compliance with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that ... Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients with limb ischaemia by autologous ... invalid value, based on acceptance criteria, was observed in the first run for the 1:10 dilution The results of the validation assay are reported in Table Page of (page number not for citation...
  • 9
  • 773
  • 0
Báo cáo sinh học: " A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

Báo cáo sinh học: " A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

Ngày tải lên : 18/06/2014, 22:20
... at all stages of the project, including organizational and scientific aspects, data analysis and interpretation as well as manuscript writing and approval All authors read and approved the final ... Individual laboratories acquired the data on their flowcytometer and analyzed the FCS files following laboratory-specific analysis strategies and software The requested format for presenting the ... CD8- Authors’ contributions SA carried out the collection and assembly of data, performed data analysis, did the visual evaluation of all dot plots and wrote parts of the manuscript LP coordinated...
  • 13
  • 752
  • 0
o cáo hóa học:" A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

o cáo hóa học:" A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

Ngày tải lên : 20/06/2014, 04:20
... at all stages of the project, including organizational and scientific aspects, data analysis and interpretation as well as manuscript writing and approval All authors read and approved the final ... Individual laboratories acquired the data on their flowcytometer and analyzed the FCS files following laboratory-specific analysis strategies and software The requested format for presenting the ... CD8- Authors’ contributions SA carried out the collection and assembly of data, performed data analysis, did the visual evaluation of all dot plots and wrote parts of the manuscript LP coordinated...
  • 13
  • 579
  • 0
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

Ngày tải lên : 20/06/2014, 04:20
... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The ... The authors would like to thank the surgical veterinary team of the AO Research Institute Davos (CH) The project was partially funded by the ESA MAP grant #AO99-122 and the AO Foundation The...
  • 4
  • 403
  • 0
Báo cáo hóa học: " A Temperature Window for the Synthesis of Single-Walled Carbon Nanotubes by Catalytic Chemical Vapor Deposition of CH4 over Mo2-Fe10/MgO Catalyst" pptx

Báo cáo hóa học: " A Temperature Window for the Synthesis of Single-Walled Carbon Nanotubes by Catalytic Chemical Vapor Deposition of CH4 over Mo2-Fe10/MgO Catalyst" pptx

Ngày tải lên : 22/06/2014, 00:20
... mg catalyst was put into the quartz tube The temperature was raised to the setting value in Ar atmosphere at a flow rate of 200 mL/min before CH4 was introduced into the reactor at 60 mL/min for ... even diameters and appear clean and uncoated It is well known that when the diameter distribution of SWCNTs is more narrow, the application values of SWCNTs are higher At this growth temperature, ... Fig 2a, only the G band (tangential mode), D band (related to disordered graphite or amorphous) and a shoulder at 1604 cm-1 (the fundamental E2g mode of graphite) are presented In the lower wavenumber...
  • 4
  • 395
  • 0
Báo cáo hóa học: " A Versatile Route for the Synthesis of Nickel Oxide Nanostructures Without Organics at Low Temperature" doc

Báo cáo hóa học: " A Versatile Route for the Synthesis of Nickel Oxide Nanostructures Without Organics at Low Temperature" doc

Ngày tải lên : 22/06/2014, 01:20
... clean surfaces of the as-synthesized nanostructures can be readily functionalized for various applications since there is neither a capping reagent nor a substrate Forth, the approach is non-toxic ... reaction time of 24 h, the average diameter of the nanoparticles increased from 60 to 80 nm (Fig 1c) Our studies indicate that the average diameter of the nanoparticles increases with the increase ... spherical nanoparticles were produced for sample heated at 100 °C for 12 h (Fig 1b) The diameters of the nanoparticles are in the range of 50–70 nm with an average diameter of 60 nm Using higher reaction...
  • 5
  • 526
  • 0
Báo cáo hóa học: " A Generalized Algorithm for the Generation of Correlated Rayleigh Fading Envelopes in Wireless Channels" ppt

Báo cáo hóa học: " A Generalized Algorithm for the Generation of Correlated Rayleigh Fading Envelopes in Wireless Channels" ppt

Ngày tải lên : 23/06/2014, 00:20
... earlier, the variances of the complex Gaussian random variables at the output of the Rayleigh simulator may have arbitrary values, depending on the variances of the Gaussian random variables at ... that, we have to calculate the variance of the outputs of Doppler filters, which may have an arbitrary value depending on the variance of the complex Gaussian random variables at the inputs of Doppler ... variances assumed to be equal to one (for simplicity of explanation) through a Doppler filter changes remarkably the variances of those variables The variances of the variables at the outputs of...
  • 15
  • 602
  • 0